Topic: I've been reading a lot of Chinese proverbs lately
Anonymous A started this discussion 3 years ago #109,102
They're way better than Chinese amateurverbs
Anonymous B joined in and replied with this 3 years ago, 8 minutes later[^] [v] #1,220,334
boof joined in and replied with this 3 years ago, 5 hours later, 5 hours after the original post[^] [v] #1,220,365
Confucious say, woman who fly plane upside going to have crack up
Anonymous D joined in and replied with this 3 years ago, 1 hour later, 7 hours after the original post[^] [v] #1,220,378
----BEGIN DNA MESSAGE-----
AGCTAGTCGATCGGATGATTACAGATCGGTTACTGAAGCTG
GGTAGCACCGTAGCTAATCGTAGCATAGGCTAGGACTGCAT
TTCGACGAGCTGATCGATAGCATGCTTAGCGATGAGCTAGG
GTGGAAGCTAGTCGTAGTAGCATCGTACTGATAGCTAGGCC
-----END DNA MESSAGE-----
AGCTAGTCGATCGGATGATTACAGATCGGTTACTGAAGCTG
GGTAGCACCGTAGCTAATCGTAGCATAGGCTAGGACTGCAT
TTCGACGAGCTGATCGATAGCATGCTTAGCGATGAGCTAGG
GTGGAAGCTAGTCGTAGTAGCATCGTACTGATAGCTAGGCC
-----END DNA MESSAGE-----
Anonymous E joined in and replied with this 3 years ago, 5 hours later, 13 hours after the original post[^] [v] #1,220,393
There's this game I remember called hanahuda, I think I spelled that wrong but my memory say it it's so, so idk, just let it go or Google it idc, but anyway, I have no idea how to play it but I've seen my mom and pops play it all the time. Again no idea how to play, but I know who is winning when either mom or dad slaps one them cards in the pile of cards they've thrown from their hand into like, "take dat shit!" It's hilarious. One time, this game was heated and ended up, with mom chasing dad around the ol' S10 Chevy blaze in the garage, taking breaks looking at each other from the driver and passenger window. That time, I followed them laughing and I glimpsed through the window from mom's side where she was standing staring at dad through to the other side, driver side window and dad was flicking her off with the funniest smile I've ever seen him ever smile in my life, when he saw me seeing him too, he acted like that finger never happened and we laughed and laughed
Anonymous F joined in and replied with this 3 years ago, 8 hours later, 22 hours after the original post[^] [v] #1,220,493
@previous (E)
It's hilarious. That time, I followed them laughing and I glimpsed through the window from mom's side where she was standing staring at dad through to the other side, driver side window and dad was flicking her off with the funniest smile I've ever seen him ever smile in my life, when he saw me seeing him too, he acted like that finger never happened and we laughed and laughed. Again no idea how to play, but I know who is winning when either mom or dad slaps one them cards in the pile of cards they've thrown from their hand into like, "take dat shit!" One time, this game was heated and ended up, with mom chasing dad around the ol' S10 Chevy blaze in the garage, taking breaks looking at each other from the driver and passenger window. There's this game I remember called hanahuda, I think I spelled that wrong but my memory say it it's so, so idk, just let it go or Google it idc, but anyway, I have no idea how to play it but I've seen my mom and pops play it all the time.
It's hilarious. That time, I followed them laughing and I glimpsed through the window from mom's side where she was standing staring at dad through to the other side, driver side window and dad was flicking her off with the funniest smile I've ever seen him ever smile in my life, when he saw me seeing him too, he acted like that finger never happened and we laughed and laughed. Again no idea how to play, but I know who is winning when either mom or dad slaps one them cards in the pile of cards they've thrown from their hand into like, "take dat shit!" One time, this game was heated and ended up, with mom chasing dad around the ol' S10 Chevy blaze in the garage, taking breaks looking at each other from the driver and passenger window. There's this game I remember called hanahuda, I think I spelled that wrong but my memory say it it's so, so idk, just let it go or Google it idc, but anyway, I have no idea how to play it but I've seen my mom and pops play it all the time.